EST details — SGN-E1243636
Search information |
Request: 1243636 | Match: SGN-E1243636 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C1027448 | Clone name: LEFL1085AC12 |
| ||
Library Name: LeMiToLf01 | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E1243636 | Length: 110 bp (110 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E1243636 [] (trimmed)
GTCAATAACAAGATAAAAGAAAGAAAAAAAATCAATAATAATATATCGATCGAGGAAGGAAAAATGATAGAGGAGATTGAGGAAGTGAGCAGTTG
CGAAGCACTGCCTCT
CGAAGCACTGCCTCT
Unigenes |
Current Unigene builds | |||||
[SGN-E1243636] | SGN-U571540 | Tomato 200607 | Build 2 | 17 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T973781 [Download][View] | Facility Assigned ID: DB704296 |
Submitter: None | Sequencing Facility: |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |