EST details — SGN-E1244048

Search information 
Request: 1244048Match: SGN-E1244048
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C991321Clone name: CD78
nocartOrdering Not Available
Library Name: vSlycmRNAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Unknown
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C991321 [CD78] Trace: SGN-T974194 EST: SGN-E1244047 Direction: Unknown Facility: Unknown
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1244048Length: 275 bp (326 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1244048 [] (trimmed) AGGTAAAGGAGATTAAGAACGGTAGACTTGCTATGTTCTCTATGTTTGGATTCTTTGTTCAAGCCATTGTTACTGGAAAGGGACCATTGGAGAAC
CTTGCTGATCACCTTGCAGACCCAGTAAACAACAACGCCTGGTCCTACGCCACAAACTTTGTTCCCGGAAAATAAAAATCTTAAAACATTCTCAA
GTTTCTGATCATTTGTTGACCATGTAAAGTTGTAATTTGTGAGTTAACTTGAACAATAGAATTGATTTTTCTTACATCTTATTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1244048] SGN-U580356 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T974195 [Download][View] Facility Assigned ID: AA824692
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: