Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E1244253

Search information 
Request: 1244253Match: SGN-E1244253
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C996555Clone name: CT236
nocartOrdering Not Available
Library Name: Sl_LeafCherry01Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: epidermis
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U565313 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1244253Length: 278 bp (278 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1244253 [] (trimmed) CTTTAAAATAACCTTGTTTTTTTATTAATGGAAACAGCAACTACTATTTGTTTTAATGGCAATATTGTTACAACTCAACAAAATTTACAAAATAG
ACTAGTGGGAGATGATACTATTTGTAAATATTTGGATAGGTATTTTGCAAATTACAAAGCAAACACCAAGAAAAGCCAAAATGGTGTGTGGTTAG
AGCTCAGATGATCTGTTGGCATATTCTTGAACCAAAGCCCCAAAGAGTGAAGGCCTTTCCAGCAAATGAGATGGTTTGTCAAACTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1244253] SGN-U565313 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T974405 [Download][View] Facility Assigned ID: AA824953
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: