EST details — SGN-E1247579

Search information 
Request: 1247579Match: SGN-E1247579
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C968823Clone name: 94AF4D10
nocartOrdering Not Available
Library Name: Sl_LeafAichi01Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-week old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1247579Length: 271 bp (286 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1247579 [] (trimmed) TTCGCTGTCCCAAAAAATCTGAAGCTTCTTGCGGTGCCATTGTTTGAACTTTATGACAATGTTCAGAGATATGGACCTGTGATATCCACGATTCC
TCAACAGCTTTCCAGGTTCCAGTTCAACATGATCCACCCGTAGATTAGGTTAGGTGGACATTCAGAACCTCCTCCTGGCATACAATCCCAAAAAT
ACATCAATATTTTTACTTTTCCAGTAGGCATATCTACCGACTTTCGTGGATATTTGTTTTCAACTAGCTTATTCATGATAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1247579] SGN-U576891 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T977808 [Download][View] Facility Assigned ID: BY999981
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: