Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E1248600

Search information 
Request: 1248600Match: SGN-E1248600
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1023933Clone name: LePU1341
nocartOrdering Not Available
Library Name: LePUOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Pericarp
Development Stage: Turning stage of fruit ripening.

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1248600Length: 177 bp (192 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1248600 [] (trimmed) GTACTCTACAANATGATATGGGAGGGCTCCAAGTTCTTCACCAGAATCATTGGGTTGATGTTCCTCCTACACCCGGTTCTCTAGTGGTGAATATT
GGAGATTTTCTGCAGAAAATCTTTTTTTTAATTATTTTTTGCAGCTCTTGTCAAATGACAAGTACTTAAGTGTCGAGCACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1248600] SGN-U580097 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T978848 [Download][View] Facility Assigned ID: CD003225
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: