EST details — SGN-E1248607

Search information 
Request: 1248607Match: SGN-E1248607
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1018738Clone name: LePU1350
nocartOrdering Not Available
Library Name: LePUOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Pericarp
Development Stage: Turning stage of fruit ripening.

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1248607Length: 398 bp (412 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1248607 [] (trimmed) GTACTCGATAAATGGAGAATCTTTATGAAGAAACAAATACATAGGGCAAGAAAGTTCTTTGATGAGGCAGAGAAAGGCGTGACAGAATTGAGCTC
AGCTAGTAGATTCCCTGTATGGGCATCTTTGGTCTTGTACCGCAAAATACTAGATGAGATTGAAGCCAATGACTACAACAACTTCACAAAGAGAG
CATATGTGAGCAAATCAAAGAAGTTGATTGCATTACCTATTGCATATGCAAAATCTCTTGTGCCTCCTACAAAAACTGCCTCTCTTCAAAGATAA
AGCATGAAATGAAGATATATATATATATAGCAATATACATTAGAAGAAAAAAAGGAAGAAGAAATGTTGTTGTATTGATATAAATGTATATCATA
AATATTAGGTTGTAGTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1248607] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T978855 [Download][View] Facility Assigned ID: CD003233
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: