EST details — SGN-E1248818

Search information 
Request: 1248818Match: SGN-E1248818
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1016392Clone name: LePU0659
nocartOrdering Not Available
Library Name: LePUOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Pericarp
Development Stage: Turning stage of fruit ripening.

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1248818Length: 276 bp (289 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1248818 [] (trimmed) GTACTCGGAAGATATGGTTGACGTTAATTTGAAGCCTACAACAAATACGTCCCAATCAGAGCAGCAAGGTGGAGGTTGTGCATGTTAGATTTGTA
CTTTAAGAGGAAGAGTAAGACATAAGTAGGAAACATGCAAAGACACAGTTGCATCCAGTTATTTTAGGGTGTTCAGAATAGCGAATTTCTTAGTT
TATGAGGTTTGCAACATGGATTTTTCTTCATGATGTACAACACTTTGTTAGACTTTATCAAGGAGGTATCTGATTAAAGGCTTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1248818] SGN-U580744 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T979068 [Download][View] Facility Assigned ID: CD003486
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: