EST details — SGN-E1251664

Search information 
Request: 1251664Match: SGN-E1251664
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C967726Clone name: LEFL1006CB09
nocartOrdering Not Available
Library Name: LeMiToLf01Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1251664Length: 236 bp (236 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1251664 [] (trimmed) CTCATTCCCCACACAATGTTTATCCAAGAAATTTGAAGTAGCTGAATTTTCTGGTCTAAGATCAAGTGGATGTGTGACTTTTTCCAACAGAGAGT
CTTCTTTCTTTGATGTTGTCTCTGCACAACTCACTCCAAAGACTACAGGATCAGCCCCGGCTAAGGGAGAAACTGTTGCTAAATTGAAGGTTGCT
ATCAACGGTTTTGGTAGAATTGGTAGGAATTTCCTCCGATGCTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1251664] SGN-U578628 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T981948 [Download][View] Facility Assigned ID: DB680203
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: