EST details — SGN-E1263990
Search information |
Request: 1263990 | Match: SGN-E1263990 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C961095 | Clone name: LEFL1048CB04 |
| ||
Library Name: LeMiToLf01 | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E1263990 | Length: 109 bp (109 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E1263990 [] (trimmed)
ACGGTGGTGTAGGTGAGGAGGAGAGTTTGAGGGATGATGTGCACACGGCAGCGGCTTATGGGGATATGGAGAAACTTCAGAGATTGGTGGAAAGT
GAGGGTTGTTCTGT
GAGGGTTGTTCTGT
Unigenes |
Current Unigene builds | |||||
[SGN-E1263990] | SGN-U583683 | Tomato 200607 | Build 2 | 18 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T994334 [Download][View] | Facility Assigned ID: DB693486 |
Submitter: None | Sequencing Facility: |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |