EST details — SGN-E1294783

Search information 
Request: 1294783Match: SGN-E1294783
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1023786Clone name: LEFL2054K21
nocartOrdering Not Available
Library Name: LeMiToFr02Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1294783Length: 744 bp (744 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1294783 [] (trimmed) AATGAAGAAGAGAATTACTGTAAAAAAATAGTTGCAGATTCTGACACCCTTTTGGGAAATTCGAATTGGGTTTGGGTTTTCTTGGGAGATGGCGT
TAAATCCTAGTAGTAGAATGGACTCACAAACGGCTGCTGAAAAAGCCGTCTCTGTGATTGGGTTAGGTTATGATTTGACAAGTGATATCCGGTTG
ACGGCCTGTAAAATCGGACCGAATGGGTATGGTTTGATAGAGATTGATCAGAAGTCGACCAAGGACCTGCTGGTGCCTGGTGGGGTGGTGGTTTC
TAATGTTTCCACCTCTATCAAGTGCGATAAAGGGGAACGAACTAGGTTTCGCTCTGATGCTCTTTCTTTTAGTCAGATGTCAGAGCAATTAAATC
AGGAGCTGTCCCTGTCTGGTAAGATACCTTCTGGGTTGTTTAATGCGATGTTTGGTCACAAGGGATGCTGGCAAAAAGATGCATCTTCGACAAAG
CTTCTCGCTTTTGATGGTTGGTTCATTACCTTGTACAATATTGAGTTGGTGAGATCCCATCTAACACTGTCTGAGCAAGTAAAACAAGACGTGCC
TTCTTCTTGNNATCCTCCTGCACTTGCAGAGTTTATTGAAAAATATGGCACCCATATTGNTGTCGGGGTAAAGATGGGAGGTAAAGATGTAATTC
ACATAAAGCAACTGCAAAATTCCNTTCTTCAGCCANNGNNNNGCANAAATTACTCNAGCAATTAGCTGANGAAAANTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1294783] SGN-U585673 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1025350 [Download][View] Facility Assigned ID: DB727214
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: