EST details — SGN-E1295324

Search information 
Request: 1295324Match: SGN-E1295324
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C974917Clone name: LEHRU05F01
nocartOrdering Not Available
Library Name: LeHRUOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: roots
Development Stage: Three weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1295324Length: 470 bp (470 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1295324 [] (trimmed) AAAAAGAATTAACCTAATTTATTATGAATAAGAGATAATATTGACAAATATACATTTTACTCATTATCCTCAAACAAGACCTGTTTTTTTTAAAT
TCCATTGAAAAAAAATTACAGGATATATACAGTGTTAACGCGGCAAAGTGGGTCCCCTAAATCCTAATCATCTGACGTCACCAACACTGATCCGT
TTCCCACCTTCGGGTCGGGTAAAACTCTGACCCATTCCTACGAATTCCATCGCCGGAGCTCCCAAAACCTCGTCGGCCGGAGCTCATGTTTAGCT
TGAGATCATAGAGATCTCTAGAAACAGGATCTGATAACGTAGCATAAGCTTCGTGAATCTCAATGAAATGCCGTCCGTCGGAAGATTCCTCCGAC
AGAGACGCAGCATCGGGATGGTATAGCTTAGCTAAATTCCGGTAAGCTGTTTTTATCTCTTTGGGTGACGCATTTGATTTTACCCTTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1295324] SGN-U584197 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1025897 [Download][View] Facility Assigned ID: DV103825
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: