EST details — SGN-E1298580

Search information 
Request: 1298580Match: SGN-E1298580
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1021871Clone name: LE2TR03I01
nocartOrdering Not Available
Library Name: Le2TROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: roots
Development Stage: 1-,2-,3-, and 4- month-old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1298580Length: 196 bp (196 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1298580 [] (trimmed) CGGCCGGGCATGATTGGTGTGTGTGGAAGTCACCAGTAATCTCCATGAAGTTGTTTGCCAAAAGTAGAGATCTGGATTTGTGGTGTTGGCCAGTA
AAAAGTACTGGTAGAACTTTTTTTTTTCTCCTTCTGTAGATCGTGTCACTGTTGTTCAAATTAATTCCTTCTTATTACGCTACTCAATTAATTCC
TTCGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1298580] SGN-U576934 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1029193 [Download][View] Facility Assigned ID: EG553405
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: