EST details — SGN-E1299846
Search information |
Request: 1299846 | Match: SGN-E1299846 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C991898 | Clone name: ES892945 |
| ||
Library Name: LeTrich01 | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Isolated leaf trichomes
Development Stage: Apical internodes of 5-week old plants.
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E1299846 | Length: 227 bp (242 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E1299846 [] (trimmed)
TTCTTCAACATCTTTTCCCTTTTCCTTTTTANGTCTTTCCTCTTTTTGTTAAATAAATGGAAGAATTCCAATAGCAAATCCAAAAGATTGCCTCC
TGGTCCATGGAAATTACCNNNAATTGGAAGCATGTTTCATTTGTTAGGTGGACTTCCNCATCATGTCTTTTAGAGANTTAGCGAAAAAATATGGA
CCAATTATGCACCTTCAACTAGGTGAAGTTTCTCTAG
TGGTCCATGGAAATTACCNNNAATTGGAAGCATGTTTCATTTGTTAGGTGGACTTCCNCATCATGTCTTTTAGAGANTTAGCGAAAAAATATGGA
CCAATTATGCACCTTCAACTAGGTGAAGTTTCTCTAG
Unigenes |
Current Unigene builds | |||||
[SGN-E1299846] | SGN-U581323 | Tomato 200607 | Build 2 | 14 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T1030478 [Download][View] | Facility Assigned ID: ES892945 |
Submitter: None | Sequencing Facility: |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |