Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E1300085

Search information 
Request: 1300085Match: SGN-E1300085
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C973087Clone name: BM956677
nocartOrdering Not Available
Library Name: Sl_LeafInf01Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Unknown
Development Stage: Developmental stage

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1300085Length: 474 bp (487 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1300085 [] (trimmed) GCTGAGGGAAGAAGATGGGCAGATATCATCAAGCCTGGATGCGTTAACACGGATCCAATCTTCCCTAACAACAAGCTCACGGGGACAGATGTTGG
TTATCCAGGAGGTTTATGGTTTGATCCCTTGGGTTGGGGTTCGGGTTCACCTGCAAAGATAAAGGAGTTGAGGACAAAGGAGATTAAGAACGGTA
GACTTGCTATGTTAGCCGTTATGGGTGCATGGTTCCAACACATTTACACTGGAACAGGCCCTATTGATAACCTATTTGCTCACCTAGCTGATCCT
GGTCATGCCACTATTTTTGCTGCATTCAGTCCCAAGTGAGAAGCAGAAGCAGAACACCTTTTGTTGTAATGATGTGTAAAAGTAACATTTGAAGT
AGATTTGTGCAAAGAAAAACTTTAATGTTTCTTTTGCCACTCAATGTAGTATACCTACATTTGGTTTGCCCTCCTGTAGAAAAAGACTCAGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1300085] SGN-U579101 Tomato 200607 Build 2 271 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1030720 [Download][View] Facility Assigned ID: BM956677
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: