SGN ID: SGN-C980227 | Clone name: DV935905 |  | Ordering Not Available |
|
Library Name: LeWpAFLP | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: whole plants, except for the roots
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E1300452 | Length: 178 bp (178 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E1300452 [] (trimmed)
TTAATGATACGGACCCATGCCTGTGGGTAAGCCTTCTTTGCCTCCTGCACCTCAGCCAAGACCTGGGTTGCATCAGTGCACCCGAACATGGGCAA
CTTCCACATGGTCCAGTATCTGCCATCGTAGTATCCTGGTGACTTATGGTTCTCACGGTACACAAATCCGTGCTCAGTCTCGA
[BLAST] [AA Translate]
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 |
Expected Error Rate: 0.0000 |
Quality Trim Threshold: |