EST details — SGN-E1304808

Search information 
Request: 1304808Match: SGN-E1304808
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C994805Clone name: ES894386
nocartOrdering Not Available
Library Name: LeTrich01Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Isolated leaf trichomes
Development Stage: Apical internodes of 5-week old plants.

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1304808Length: 463 bp (463 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1304808 [] (trimmed) TTANGGCCGGGTCNNNGCTTTGCGGTGANTCGCTCTGTCCCTGGTCCATCGTGTGCTGATGTGCTCCGGGCGATGCAGTTTGAGCCTGAACTCAT
GTTCGAGACTCTCAAGCACCGNGCAGAGGAATTCTTGGAACAAGGAGAAGGAGAAGGCGAAGGTGTTGCCTTTGGATCTTTGACCAGCAGCTTAG
CTCAGTCCTTCCACAACATGCCTTACCTTTCGTCTTGCTGCTTCACTGCAGAAGCCACTGCCAATGCCAATACCAATACCAATAATGGTGGCTAT
TACTATTACAGTGAAGACAATGCTGCAGCAGAGGAAGATGAGATTTGGTCCTACTAAACTCTGCTTGAAGTGTCTCTTGTTAGCATCTCCAGTTT
GTTTTAGTTTGTGGTCGAGGTCGTCTGTTTTTTTANAATAATCCCACCCCTTAGTTTGGGTGCATGTTAATTACNTNCGTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1304808] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1035464 [Download][View] Facility Assigned ID: ES894386
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: