EST details — SGN-E1308080

Search information 
Request: 1308080Match: SGN-E1308080
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1010887Clone name: EY506124
nocartOrdering Not Available
Library Name: Sl_FruitQTLOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Unknown
Development Stage: late maturation (breaker and red ripe)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1308080Length: 169 bp (185 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1308080 [] (trimmed) ACACCAACAAGAACCGCCACTCCCCAGCCATCATGGACACATTCAAATGCTGAAATCATAGCATCAATGTGACCAGTACATTCCACACTCCTATC
GACTCCGCCATCAGTCATCTCAGCAATTACCTCTTGAACTGGTTTACTATAGTCCTTTGGGTTCACAAACTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1308080] SGN-U579420 Tomato 200607 Build 2 345 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1038750 [Download][View] Facility Assigned ID: EY506124
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: