EST details — SGN-E1308087
Search information |
Request: 1308087 | Match: SGN-E1308087 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C1013213 | Clone name: EY506131 |
| ||
Library Name: Sl_FruitQTL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Unknown
Development Stage: late maturation (breaker and red ripe)
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E1308087 | Length: 203 bp (203 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E1308087 [] (trimmed)
GGCGGACTAAACTTTCTGTCCTAGAAAAGGAGCTTCTACTGTTTGAGAAAAAAGACCAATAAATTGTCACTGTCTTATTTTCCCTTTCGTGTTTG
GTTGAGTTGTAACATTCCATCCATGTCTCTTCTTTTGTCTTTTGCTTAGATGTTGTGCTTTGCCATATCTCTTTCGATTCTTGTAAAAAATGCAA
ATTCTCTCTGTTT
GTTGAGTTGTAACATTCCATCCATGTCTCTTCTTTTGTCTTTTGCTTAGATGTTGTGCTTTGCCATATCTCTTTCGATTCTTGTAAAAAATGCAA
ATTCTCTCTGTTT
Unigenes |
Current Unigene builds | |||||
[SGN-E1308087] | SGN-U579420 | Tomato 200607 | Build 2 | 345 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T1038757 [Download][View] | Facility Assigned ID: EY506131 |
Submitter: None | Sequencing Facility: |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |