Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E1314564

Search information 
Request: 1314564Match: SGN-E1314564
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1034193Clone name: CACATN1-6G84TV
nocartOrdering Not Available
Library Name: Ca_AtMixTis1Organism: Coffea arabica

Tissue: Mixture of leaf, fruit, flower, root and calli
Development Stage: Adult trees

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1314564Length: 866 bp (866 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1314564 [] (trimmed) GGCCGGGGGGGAACAACAATTTACTTAGCCCGGGCAGTTGCCCGCGTGAGTCCTCACCACCACCCTCCCCCGCGACGCCCCTGACCGAATTCCTC
CAATTGGAAAGCGAGACCCAAAAAACTCCACGTCTCCACCTCCGGGATCCGAATCCACGTTCAACGACGTAGTTTTCTCTAGATTATAAGCCCTA
AGTCAACCTGCAACTTCCACATTTTTATGATCCAAAGGGTGAAATGAACGAAGTAATGACGGCAGCCGATGCATCCTCCAGCTTACGCCCATACT
CATCTCCACACTCCATTTATCCCTCCAATCTCCCCCTTGTCTCCGCTTTCCTCGCTTGTCTTGTTGCCCAATTTCTCAAGATCTTTACCCATTGG
TTCAAGGAGAGGAAATGGGATTCGAGAAGGGTGCTTAGCTCTGGTGGAATGCCGTCATCACATTCAGCAACTGTTACTGCTCTTGCTGTAGCAAT
AGGTTTGCAAGATGGAGCGGGAACATCTGCTTTTGCCATTGCGGTCGTTTTGGCATGTGTTGTAATGTATGGTGCTACTGGTGTTAGGCTTCATG
CCGGTCGGCAGGCTGAATTATTGAATCAGATAGTTTGTGAATTGCCCCCTGAACATCCTGTCGCTAATGTTAGGCCTCTGCGAGATTCACTTGGT
CACACTCCTTTCCAGGTTGTTGCTGGTGCTTTGCTTGGATGTGTGGTAGCCTATCTCCTGAGTAGCTCTGCTTAGAATGGTGCTGGTGATTCTTC
AGAGCCAAGTGCTATAAGAGGCTTTTGTACTTTCTGATTCGTTCAGGCTGCAGCTTGACTGGTCGCTTCAAGTAGAAAGGAAAGAGCTGGGAGTT
AGGAATCGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1314564] SGN-U607219 Coffea arabica Build 1 7 ESTs assembled
[SGN-E1314564] SGN-U637915 Coffee species Build 1 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1045222 [Download][View] Facility Assigned ID: GR996907
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: