Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E1314861

Search information 
Request: 1314861Match: SGN-E1314861
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1040469Clone name: CACATN1-6876TV
nocartOrdering Not Available
Library Name: Ca_AtMixTis1Organism: Coffea arabica

Tissue: Mixture of leaf, fruit, flower, root and calli
Development Stage: Adult trees

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1314861Length: 791 bp (791 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1314861 [] (trimmed) AGACGCATTTTTGATTAGCCGAAATGTTGAAGATATGAAGGCTGCTGCTGGCACAATGGATGGTATACTTGACTGTGTCTCAGCTAAGCATCCCT
TAGTACCCTTGCTTGGTCTTCTCAAGTCTCATGGAAAGCTTGTCACTGTGGGGGTACCAGCACAGCCACTTGAGCTTCCTATCGTCCCTCTAGTT
GTAGGAAGGAAGTTGGTTGGTGGAAGTAATGTTGCAGGAATAGCAGAGACACAAGAGATGATTGATGTGGCTGGAAAGCACAACATCACCGCAGA
TATCGAACTTGTTTCCATGGAAGATTTGAACACAGCTATGGAACGTCTTGCAAAAGGTGATGTGAGACATCGCTTTGTCATTGATGTTGCCAACA
CCTTGAAAGCTCCTTGATCTCGTGTTTGGGAAGATGTTACCAAGATCCGATTCCCATACAGATTCTTGAGTGACATGCTTTGGCAGCGTCTCATA
TCCCTCTGGCATGGTGAAATTTGGTTTTGTCTTCTTAATTTCGAGTGACAAATTTGGGAAGCTACTTTTTGTAACAGTTTCACTCTGACTTGGAT
GCAAATGAGATATGATACTGAATAATGTTGTTGTTTCTGTAACAAGCTATTCCAGGGCTCAGCAGACCACAGGGCCTGTGTGAACTAGGTGTTGC
CTTTATGTTATGTATGCCAGCAGGCTTTGTAAACTCGTACGGAATTGGGATAATACGTCATTATGATGCTGTCTCGTGTGTAAATGGAAGAGACA
ATTAATAATAATAATAATAAAATGTTGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1314861] SGN-U605568 Coffea arabica Build 1 8 ESTs assembled
[SGN-E1314861] SGN-U633368 Coffee species Build 1 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1045520 [Download][View] Facility Assigned ID: GR997214
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: