EST details — SGN-E1316192

Search information 
Request: 1316192Match: SGN-E1316192
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1039774Clone name: CACATN1-5890TV
nocartOrdering Not Available
Library Name: Ca_AtMixTis1Organism: Coffea arabica

Tissue: Mixture of leaf, fruit, flower, root and calli
Development Stage: Adult trees

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1316192Length: 845 bp (845 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1316192 [] (trimmed) GGCCGGGGGATAGCAGAAGGGTCATTCATTCACAGGTCTGCAAAATGGCTTACAACGTATTACCCTCCACAGTCAATGCCCCGCGGGAAAATTAT
ATCCACAACCCAGCAGCCATCTTTCCACAGCTACAGATACCTAAGGTTGACCTCTGCGTCCTCAATAGTGAACCATCATCACCTGAAGCCACTCA
GGAGCTCAAGATTCTCCGGTTTGCTTTGACCGTGTGCGGTTTCTTTCAGGTTGTTAGTCACGGAATAGATATTTCACCCCTTGAGGAATTGTATG
ATGTTACTAAACGATTTTTTTTACTTCCACCGGAAGAGAAGCACAAATATTCACGACCAGCTGGTGATCTTGATCTTGCTGGTTTTGGAAATGAT
CAAATTCTCACTCAACATCAGACCCTTGATTGGAATGACGTGTTGTATCTCGATTTGTATCCTGAAGATCAAAGGACACTAAAATTGTGGCCTGA
CAATCCTAACGACTTCAGGAAAGTTTTGCTCGAGTGTAGGGCGAAGTTACAAAAATTAAATGAGCTCATCCTCAAGGCCATGGCAAAATCGCTCA
ACTTGGAAGACAATACCTTTCTGAGGCAATATGGAGAAAGCCCAAGGGTGCTATCAAGATTTAACTCTCATCATCCGTGTTCAGGATCAGGACCC
CAAGTTGAAGCCAAACCGCATTCGGATGCATCGGCATTGACTTTTTTCTTACAAGACAAACCAGTGGAAGCCTTTCAAGTCCTAAGAGGTGATAA
ATGGTTCAGACTTCCTGCCATTGCTCATCCTGCTATCCTTGTTATGCCTGGGGACCAAGCTGAGATAATGACTAATGGCCTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1316192] SGN-U605696 Coffea arabica Build 1 3 ESTs assembled
[SGN-E1316192] SGN-U633999 Coffee species Build 1 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1046851 [Download][View] Facility Assigned ID: GR998580
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: