Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E1320127

Search information 
Request: 1320127Match: SGN-E1320127
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1041257Clone name: CACATN1-2480TV
nocartOrdering Not Available
Library Name: Ca_AtMixTis1Organism: Coffea arabica

Tissue: Mixture of leaf, fruit, flower, root and calli
Development Stage: Adult trees

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1320127Length: 837 bp (837 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1320127 [] (trimmed) CTCGGCAGCGTGGGCCAGCCTTTATTATCAACACAACCACAGTCTTAAGCCCTCCTCAGACCCTCGTCTCGGGATCCTATGTGCTGTCAACTCCC
TCTTCCTCTTTCTCAATCCTTCCAATATCTTCTACTCACCAACCCCTTCAGAGCCACCCTGCTTCTTTCTTTAACAATAATCTCCAAATTATTAA
CTTTCTGTAGCTTTTCCAGCGCACCTTGTCTGTTTTATTTGTCGCTTTTACTGGGGTTCTAAGTCCGATCAAGATTTTGCCTAAGAATCACAAGA
TTTGATTTTGCCATGGGTCTTTCGCCTTACTCAGCTCCAGCCGATGGAGGAGTGTTTTGTGTAATTTCAGTAAACACAGCCATATCAATCTCCAT
AGTCAAGGAGATATTTCGTTCAATCCTTCAGGTTGTTGGCATTCGCATTGCAGCTTGGGAAGATTATTCCGTTGACAACACCTTGGAATCATTAG
AATGTCGTGGAAGCCCCTCTGAGTCCTATATGGAGGAGTTCCGAAGCAGAACTCCAGCAATTCGTTATGATTCAATCCATAGCTGCAGTCGCCCC
CGCCATGAGTGCCCAGTCTGCCTGACAGAATTCGAGCCAGATGCAGAGATTAACCACCTTTCTTGCGGCCACGTATTTCATAGACTATGCCTGGA
AAAGTGGTTGAAATATTGGCATGTTACATGTCCTCTTTGCCGGAATTATATGCTACCTCAAGAAGGGCTTGAAAACACTTGTCCTATGTGAGCAT
AATACAAAATTGTTGAAACTCTGTCTTTAGTTGTACAGCATAGTAGTGTACAAACAATTTACTGCTTGTAGTGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1320127] SGN-U606244 Coffea arabica Build 1 4 ESTs assembled
[SGN-E1320127] SGN-U630070 Coffee species Build 1 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1050792 [Download][View] Facility Assigned ID: GT002633
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: