EST details — SGN-E1325932

Search information 
Request: 1325932Match: SGN-E1325932
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1047952Clone name: CAET42MIX-CFEYQ46TV
nocartOrdering Not Available
Library Name: Ca_AtMixTis2Organism: Coffea arabica

Tissue: Mixture of leaves, flowers, fruits and meristems
Development Stage: Adult trees

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1325932Length: 832 bp (832 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1325932 [] (trimmed) GGCCGAGGGGGTCTCCCACCGTACGCACTTATAAGCCTTCCAATCCCAACTCGACAACTCAATCCATCTTCATCATAAGCTGCTGAAATGGCAGA
ACCAAAGCTCTTTGAACTCAACAATGGCACCATCCAACTCAAGGTCTCCAGTCTTGGCTGTACCATCACCTCATTGTCTGTCCCCGATAAAAATG
GAAAATTGGGCGATGTTGTTCTTGGATTTGACGCACTTGAGCCGTATCTGAAAGGGGCTGCACCTTATTTTGGCTGCATTGTTGGCCGGGTTGCA
AACAGGATTAAAGATGGCAAATTTACACTCGATGGTGCTCACTACTCCTTGCCCATCAACAAGCCTCCAAACAGTCTCCATGGTGGGCATAAGGG
ATATGACAAGGTTGTGTGGGAATTAGTGGAACACAAGCAAGGCAATGAACCATCAATCACATTCAAATACTATAGCCGTGATGGGGAGGAAGGTT
ATCCAGGGGAATTAGCTGTAACTGCAACTTATACACTCACCTCAGCAACAACATTGAGGCTAGACATGAAAGCTGTGCCTCAAAACAAACCAACC
CCAGTGAGTTTAGCTCAACATACCTATTGGAACTTACGAGGCCACAACTCAAGAAACGTTCTTGATCATACTATTCATATATGGGCAAAGCATGT
TACTCCTGTGGATCAGAATACAATCCCAACAGGAGAAATCATGCCAGTTAAAGATACTCCTTTTGACTTCACCACTGAGCAGAATATTGGTAGTC
GTATCCATGAGGTTGGCATATGCTATGACCACAACTATGTGCTTGATTGTGAAGATGAGCAATGGGGGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1325932] SGN-U609822 Coffea arabica Build 1 4 ESTs assembled
[SGN-E1325932] SGN-U636438 Coffee species Build 1 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1056607 [Download][View] Facility Assigned ID: GT009311
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: