EST details — SGN-E1331783

Search information 
Request: 1331783Match: SGN-E1331783
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1053475Clone name: CACAT36FL_16_K08_123.F
nocartOrdering Not Available
Library Name: Ca_DevFlowOrganism: Coffea arabica

Tissue: Flower
Development Stage: developed flowers

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1331783Length: 382 bp (382 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1331783 [] (trimmed) GGCTGTTAAAGGACCCAAGGGTCGTTTTAGATATCAACCGGGACAAGTTAGAGCATTTGGAATGCTTGCTGGAGGTTCTGGCATCACCCCAATGT
TTCAGGTTGCCAGAGCTATTTTAGAAAACCCAAATGACAAAACAAATGTACATCTCATCTATGCTAATGTTGCCTATGAGGACATTCTTTTGAAG
GAAGAGTTGGAGTCTTTGACTGCTAATTATGCTGGCCGTTTCAAAGTTTACTATGTCCTCAATCAGCCTCCAGAAGTATGGAATGGTGGTGTTGG
CTTCGTCTCAAAGGAAATGATTCAAGAGCATTGCCCTGCACCTGCATCTGACATTAAGGTATTGAGATGTGGACCTCCACCAATGAACAAGGCTA
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1331783] SGN-U606817 Coffea arabica Build 1 10 ESTs assembled
[SGN-E1331783] SGN-U631241 Coffee species Build 1 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1062423 [Download][View] Facility Assigned ID: GR980354
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: