Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E1334951

Search information 
Request: 1334951Match: SGN-E1334951
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1056154Clone name: CACAT36FLBUD_Q1_05_G01_007.F
nocartOrdering Not Available
Library Name: Ca_FlowBudOrganism: Coffea arabica

Tissue: Buds
Development Stage: flower buds

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1334951Length: 666 bp (666 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1334951 [] (trimmed) GGTTGTGATAGTGGATGTCGATGACTACCGTTTGTCGGTTGCCAAACAGCTTGGTGCGGATGAAACTGTCAAAGTTTCTAACAACATGCAGGATG
TGCCGGAGGAAGTGGAACAGATTCGGAAGGCTATGGGGGCTGAGATTGATGTGAGTCTTGATTGTGCTGGGTTCAATAAAACCATGTCTACAGCC
CTTGGTGCCACCCGTGCAGGCGGCAGAGTCGGTCTCGTTGGTTTGGGTCACAAGGAGATGACTCTTCCTCTCGCCCCTGCTGCTGCGAGGGAGGT
CGACATTATAGGAATATTTCGGTACACGAACACGTGGCCCTTGTGTCTTGAGTTTATAAGCAGCGGCAAGATTGACGTGAAGCCCTTGATAACCC
ACAGGTTTGGCTTCTCCGAGCAAGAGGTCAAAGAAGCCTTTGAAACCAGCGCTCATGGTGGCACTGCCATTAAGGTTATGTTTAACCTCTGATGG
AGAGAGGTGATGAAGTGGTACCGCCTGCTCCTGCTGCTTGTAATGTAAATACAGAAAATGCAAACGAAGATGTTGTAGGCATAAATAAATGTGGA
AAAAGCAGTAGTAGTATTTTGTAGTATTAGTATGTATTGGTGTTGCATGAACGAATGAAACTTCTTGTTGATGTGTTAAAATGGGTGTCCCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1334951] SGN-U604890 Coffea arabica Build 1 10 ESTs assembled
[SGN-E1334951] SGN-U636067 Coffee species Build 1 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1065625 [Download][View] Facility Assigned ID: GR983744
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: