Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E1335420

Search information 
Request: 1335420Match: SGN-E1335420
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1057883Clone name: CarCTFrHh24FL_Q1_07_K17_267.F
nocartOrdering Not Available
Library Name: Ca_Fruit100dOrganism: Coffea arabica

Tissue: Fruits
Development Stage: Fruits with 100-115 developing days

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1335420Length: 851 bp (851 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1335420 [] (trimmed) CATAGGATTCAGGACTGACAAGAAAGGTCAAACTGCACTCCACATGGCTGTGAAGGGCCAAAACGTGGAGATTGTACAGGAATTAATAAAACCTG
ACTCCTCTGTTCTGAGCTTGGGAGATAACAAAGGAAACACGGCACTCCACATCGCAACAAGGAAGGGTCGAACTCAGATGGTACAGAGTCTGATA
GCAAGTGGAGGCATTGAGATCAATGCAACTAATAAGGCTGGAGAAACCCCCCTTGATATTTCGGAAAAGCTTGCAATACCAGAATTAGATAGCAT
TTTAAAAGAGGCAGGAGCTCTTCATTCTCAAGATCATGGAAAACCACCAAATGCTGCAAAGCAACTCAAACAGACTGTCAGTGACATAAAACATG
ACGTGCAGTCCCAACTCCAACAATGCCGTCAGACTGGCTTTAGAGTAAGGAAGATTGCTAAGAAAGTGAAGAAGCTCCACATTAGTGGCCTTAAC
AATGCCATCAACTCTGCAACTGTTGTTGCTGTCCTGATTGCAACCGTTGCTTTTGCAGCCATCTTCACTGTGCCCGGCCAGTATGTCGAGGAACG
AACACCAGGATCTTCACTTGGGCAAGCCCATATAGCTAAAAATGCAGCTTTCTTAGTCTTCATTTTGTGCGATAGTCTGGCCTTATTTATCTCCC
TTGCTGTTGTGGTGGTACAGACATCTATTGTTGTGATAGAACAGAGGGCAAAGAAGCAACTTATGTTCGTGATAAACAAGCTTATGTGGACGGCA
TGCCTCTTCATTTCATTGCCTTTTATTCTCTCACCTTTGTGGTTGTTGGACGTCATGAAAAGTGGCTTGCTGTGTATGCAACCATAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1335420] SGN-U608218 Coffea arabica Build 1 4 ESTs assembled
[SGN-E1335420] SGN-U633008 Coffee species Build 1 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1066090 [Download][View] Facility Assigned ID: GR991464
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: