EST details — SGN-E1335607

Search information 
Request: 1335607Match: SGN-E1335607
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1057416Clone name: CarCTFrHh24FL_Q2_04_C24_371.F
nocartOrdering Not Available
Library Name: Ca_Fruit100dOrganism: Coffea arabica

Tissue: Fruits
Development Stage: Fruits with 100-115 developing days

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1335607Length: 773 bp (773 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1335607 [] (trimmed) TTGGGACTTCCCATTGGACAGCATATAAGTTGCAGGGGTAAGGATGGTCAAGGGGAAGAGGTCATAAAACCATATACTCCAACCACATTGGACTC
TGATGTTGGATACTTTGAATTAGTTATAAAGATGTATCCTCAAGGAAGGATGTCTCACCATTTCCGTGAACTGCGTGTTGGAGATTATTTGGCTG
TTAAAGGACCCAAGGGTCGTTTTAGATATCAACCGGGACAAGTTAGAGCATTTGGAATGCTTGCTGGAGGTTCTGGCATCACCCCAATGTTTCAG
GTTGCCAGAGCTATTTTAGAAAACCCAAATGACAAAACAAATGTACATCTCATCCATGCTAATGTTGCCTATGAGGACATTCTTTTGAAGGAAGA
GTTGGAGTCTTTGACTGCTAATTATGCTGGCCGTTTCAAAGTTTACTATGTCCTCAATCAGCCTCCAGAAGTATGGAATGGTGGTGTTGGCTTCG
TCTCAAAGGAAATGATTCAAGAGCATTGCCCTGCACCTGCATCTGACATTAAGGTATTGAGATGTGGACCTCCACCAATGAACAAGGCTATGGCA
GCTCATCTTGAAGCTCTTGGTTACACCCCAGAGATGCAATTCCAATTTTAATTTTGTCACAAATTTAGCCCTACACATGGTTTCATTGTTAGTGT
GGGGGGAACAGAATTTTTCATGTTGGAATAGCAGGGGAAATGAATCATGTAATGCAAATTGTTGACGTTGTTCCTGTGAACTTGGAGCAATAAAA
TTTCCCAGAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1335607] SGN-U606817 Coffea arabica Build 1 10 ESTs assembled
[SGN-E1335607] SGN-U631241 Coffee species Build 1 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1066277 [Download][View] Facility Assigned ID: GR991667
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: