EST details — SGN-E1337638

Search information 
Request: 1337638Match: SGN-E1337638
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1059655Clone name: CACAT36FR26_Q1_03_K05_075.F
nocartOrdering Not Available
Library Name: Ca_Fruit26dOrganism: Coffea arabica

Tissue: Fruits
Development Stage: fruits

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1337638Length: 367 bp (367 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1337638 [] (trimmed) ACTAGTTCTGGGTATTGTTTTGGCTCAAGGTTTCGATTTCTGGAAGGATACTTTGCAACACCCTTGTCATCCTCTGCAAAACCACATCAATTCTT
GGCCTGACAAACCTAAGAACTACCGAGAGGTTATAGGACCATACACAACTCAAGTGAGGAAAGTGGCCATGAAAATTATGGACATGATCTATCAA
GGTTTAGGGCTTGAAGCGGACGACACTGAGAAAGAATTCGACAACTATAATTTAGCTTTCTCCATCAACCATTATCCAGCATGCCCAGACCCTGC
ATTAGCCTTGGGTTGCTGCAGACACTCTGATCCTGCAATCCTAACTCTTCTTCAGCAAGAGGTGTATGGGCTTCAACTAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1337638] SGN-U607097 Coffea arabica Build 1 6 ESTs assembled
[SGN-E1337638] SGN-U634914 Coffee species Build 1 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1068307 [Download][View] Facility Assigned ID: GT011280
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: