EST details — SGN-E1337658

Search information 
Request: 1337658Match: SGN-E1337658
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1058769Clone name: CACAT36FR26_Q2_01_A14_209.F
nocartOrdering Not Available
Library Name: Ca_Fruit26dOrganism: Coffea arabica

Tissue: Fruits
Development Stage: fruits

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1337658Length: 346 bp (346 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1337658 [] (trimmed) CGTGGGGTTGAAGCACTGTGGGCCGTGCGTGAAGGTGTATCCGACGGTGCTCAAGTTGTCGAGGCAGATGGCTGATACTGTCGTATTCGCCAGAA
TGAACGGCGATGAGAATGATAGCTGTATGAGGTTCTTGAGGGACATGGACGTGGTTGAAGTGCCCACGTTTTTGTTCATAAGAGATGGAGAAATT
TGTGGGAGATATGTGGGATCTGGCAAGGGAGAACTAATCGGTGAACTTCTTAGATACCAAGGAGTTCGAGTGACTTAGGTCAAAAGAACAAACCG
GAAGAAGATTCACCAGCAAATTACACAATTCAATTGGCTGTGTGAAACTTTGTAACGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1337658] SGN-U609739 Coffea arabica Build 1 11 ESTs assembled
[SGN-E1337658] SGN-U629889 Coffee species Build 1 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1068327 [Download][View] Facility Assigned ID: GT011300
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: