EST details — SGN-E1340890

Search information 
Request: 1340890Match: SGN-E1340890
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1062390Clone name: CACAT45FR_M003_153.x1
nocartOrdering Not Available
Library Name: Ca_Fruit28d2Organism: Coffea arabica

Tissue: Fruit
Development Stage: 28 weeks old fruits

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1340890Length: 329 bp (329 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1340890 [] (trimmed) AGGAAGAGGTCAGTTGGCGTGGATTTTACATTCGCTAGTTTTCTCGGGGCTCTGTCGATCAAGAGAAAGAAGAAGAAAGAAGATATGGCTCTCCC
AAAGGCTAAGGAGATCGTGTCGGCCAATCCTGTTGTCGTTTTCAGCAAGTCGTACTGTCCGTTCTGCGTCAACGTGAAGAAGCTGCTGGGTCAAG
TTGGTGCCAACTTCAAGGCCGTCGAGCTGGATGTCGAAAGTGATGGAAGTGAGATTCAGGCAGCTCTTGCTGAGTTGACTGGACAAAAGACTGTG
CCCAATGTCTTTATTGGGGGCAAGCACATTGGTGGTTGTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1340890] SGN-U605840 Coffea arabica Build 1 33 ESTs assembled
[SGN-E1340890] SGN-U631600 Coffee species Build 1 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1071562 [Download][View] Facility Assigned ID: GR990988
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: