EST details — SGN-E1345131

Search information 
Request: 1345131Match: SGN-E1345131
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1067276Clone name: CAHT1343PER-CAHT983TV
nocartOrdering Not Available
Library Name: Ca_FruitParOrganism: Coffea arabica

Tissue: parchment
Development Stage: Fruit parchment

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1345131Length: 338 bp (338 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1345131 [] (trimmed) ACAAAAGACTGTGCCCAATGTCTTTATCGGGGGCAAGCACATTGGTGGTTGTGATGCAACAACTGCATTGAACCAGAACGGCAAGCTTGTTCCTT
TGCTAACTGAAGCCGGAGCTGTTGCTAGTGTGTCTGCTTAGAAGACCTTCAAGCATACGTTGGATGAATTATGCATGTTTCTGAAGCCATTATAT
AAATAAAGCAATGTTTGTTAGTGTTTCGTTTCATTTTTCTGTTTGAGAATAAATTATGAATAGAAGCTTCGCTGGATTCCTGTACTATATTATTA
TTGTGGAAGTCAACAAAATAAACTAGTCTGACCATCTTTTGCTGAAAAAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1345131] SGN-U605840 Coffea arabica Build 1 33 ESTs assembled
[SGN-E1345131] SGN-U631600 Coffee species Build 1 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1075792 [Download][View] Facility Assigned ID: GT016464
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: