EST details — SGN-E1345533

Search information 
Request: 1345533Match: SGN-E1345533
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1067769Clone name: CAHT1343PER_Q1_03_O01_015.F
nocartOrdering Not Available
Library Name: Ca_FruitParOrganism: Coffea arabica

Tissue: parchment
Development Stage: Fruit parchment

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1345533Length: 290 bp (290 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1345533 [] (trimmed) CCTGCATCTGACATTAAGGTATTGAGATGTGGACCTCCACCAATGAACAAGGCTATGGCAGCTCATCTTGAAGCTCTTGGTTACACCCCAGAGAT
GCAATTCCAATTTTAATTTTGTCACAAATTTAGCCCTACACATGGTTTCATTGTTAGTGTGGGGGGAACAGAATTTTTCATGTTGGAATAGCAGG
GGAAATGAATCATGTAATGCAAATTGTTGACGTTGTTCCTGTGAACTTGGAGCAATAAAATTTCCCAGAAGTTTATGACTGTCTTTGAATTGCGT
AGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1345533] SGN-U606817 Coffea arabica Build 1 10 ESTs assembled
[SGN-E1345533] SGN-U631241 Coffee species Build 1 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1076203 [Download][View] Facility Assigned ID: GT016957
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: