EST details — SGN-E1347091

Search information 
Request: 1347091Match: SGN-E1347091
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1069116Clone name: CarCatLeEnri2_36-B09-PAL17d
nocartOrdering Not Available
Library Name: Ca_JtLeaf2Organism: Coffea arabica

Tissue: Leaf
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1347091Length: 680 bp (680 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1347091 [] (trimmed) GGCCGGGGATTGCGCCTACTCCACTCCACATGTGTTAGGCCATATCGGTCGGAGTTTCATCTCCAGCAACAACAACATAGCAAATTTCCTGCTCT
AGTCATGGCCACGGTCGCAAATTTCTTAGCCAAGCCACCAACCGATCAACTTGCCGCCGTTACAAAGACAAGTCCCTACTTCTACCGCGGCTCTC
CTCACCTTCCATTTTCCTTGAAACCCAGACAGTATTCTTTTCCAGGCATCCACAAACGTCAGGATCTATTCATTGTTAAGGCAGCAGCTTCAGCA
GCTGGTGTTAAGAAGGAAAAGGCCAGTGATGAGAGAGTGAAAAAAGTCCACAGCATCGAGGAATTCGATGAAGCACTTCGCTCGGCCAAGAACAG
GTTGGTCGTAGTAGAATATGCGGCTAGCCACAGTCTCGAGAGCAGCGACATCTACCCTTTTATGGTGGACCTCAGCAGAACATGCAACGACGTGG
ATTTCCTACTGGTCTTGGGCGATGAATCCGAGAAGACTAGGGAACTCTGCAAGCGGGAGAAGATAGACAACGTCCCGCATTTCAGCTTCTACAAA
GGCATGGAGAAAATTCACGAAGAAGAAGCGATAGGCCCTGATCGGCTCGTCGGGGATGTTCTATACTACGGGGACAATCATTCGGCTGTGGTGCA
GCTTCACAGCAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1347091] SGN-U609739 Coffea arabica Build 1 11 ESTs assembled
[SGN-E1347091] SGN-U629889 Coffee species Build 1 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1077750 [Download][View] Facility Assigned ID: GT017588
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: