EST details — SGN-E1348016

Search information 
Request: 1348016Match: SGN-E1348016
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1070460Clone name: CarCatLeEnri2_68-C10-PAL17d
nocartOrdering Not Available
Library Name: Ca_JtLeaf2Organism: Coffea arabica

Tissue: Leaf
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1348016Length: 544 bp (544 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1348016 [] (trimmed) CAAACATGAAGACGATGACTTTCTCACTGTGCTTCTCCAGGATCATGTAGGAGGTCTTCAGGTTCTTTACGGGAACCAGTGGATCGATGTTCCTC
CAACACCTGGAGCTCTTGTAGTCAATATTGGGGACCTTCTACAGCTGGTGTCCAATGACAAGTTCCTCAGTGCTCGGCATCGAGTAGTAGCCAAT
CGTGTTGGTCCCAGGGTATCAGTGGCATCCTTCTTTACCACATATCTCCGGCCATCTACAAAGCTCTACGGACCTATTAAGGAGTTGCTCTCAGA
AAATGATCCACCCAAGTACCGGGAAACCACAATTAAGGATTATTCAGCCTACTTCGACGCCCAGGGACTCGATGGAACTTCTCCTTTGCTGCACT
ACCGGCTGTAATTATCCGTATGGAAATGATACAGATTTAACCTCGAGTGAATTGTAAGAGTGTGAGATCACAATACTTAAAAACTCTGCTCAACT
CCGATAGATGTTTTCTGCATAATGAACAACGGTACAGAAAAAAAAAGGCATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1348016] SGN-U604986 Coffea arabica Build 1 2 ESTs assembled
[SGN-E1348016] SGN-U632124 Coffee species Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1078684 [Download][View] Facility Assigned ID: GT018638
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: