EST details — SGN-E1351603
Search information |
Request: 1351603 | Match: SGN-E1351603 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C1073985 | Clone name: MN-SSH3-E12 |
| ||
Library Name: vCaramRNA | Organism: Coffea arabica |
Tissue: Unknown
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E1351603 | Length: 132 bp (132 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E1351603 [] (trimmed)
TACAGTCCAATGAAATACTATGGCATCGCCAAACCAGGGAGCCACATTGGAATCAATGGCCTTGGTGGGCTTGGTCATGTGGCTGTTAAGTTTGC
GAAGGCCTTGGGGGCCAAAGTGACAGTTATCAGTAC
GAAGGCCTTGGGGGCCAAAGTGACAGTTATCAGTAC
Unigenes |
Current Unigene builds | |||||
[SGN-E1351603] | SGN-U605568 | Coffea arabica | Build 1 | 8 ESTs assembled | |
[SGN-E1351603] | SGN-U633368 | Coffee species | Build 1 | 17 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T1082267 [Download][View] | Facility Assigned ID: DQ124040 |
Submitter: None | Sequencing Facility: |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |