Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E1351749

Search information 
Request: 1351749Match: SGN-E1351749
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1074105Clone name: MN-SSH4-C03
nocartOrdering Not Available
Library Name: vCaramRNAOrganism: Coffea arabica

Tissue: Unknown
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1351749Length: 132 bp (132 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1351749 [] (trimmed) TACTGATAACTGTCACTTTGGCCCCCAAGGCCTTCGCAAACTTAACAGCCACATGACCAAGCCCACCAAGGCCATTGATTCCAATGTGGCTCCCT
GGTTTGGCGATGCCATAGTATTTCATTGGACTGTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1351749] SGN-U605568 Coffea arabica Build 1 8 ESTs assembled
[SGN-E1351749] SGN-U633368 Coffee species Build 1 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1082417 [Download][View] Facility Assigned ID: DQ124041
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: