SGN ID: SGN-C14714 | Clone name: cLEC-8-E12 |  | Order Clone |
|
Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E200042 | Length: 484 bp (867 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E200042 [] (trimmed)
CCCCCCCCTTTCTTTTTTTACAGAAACGATGATGTTACAATCAATGGCTCTCAATTCCTTATCTTCTACTTCTCTCGTTGGAGTTAATAATGAGC
TTCATTCTTCAAGATTTCAAGTAAATTCGTCGACAATTCGTTGTTGTTCAAGAAGTCATGCTTACATACCAAAGCTCGAGCCTTTTAGCAGAACC
AAGTTTGATAGAGTTTTTAAAGATCCCCCTTTGATCGAAAAATCTGAAAATGAACTTGCCGATTATTGTTCTGTTCTAGAAGGTGATGATTCTTA
TAGCTGCTGGCAAGCCTATTTTGAACTCAAAGATCTTGAAAAAGAAGCACCTAAGGAGGAGGTAGAGAGGCTAATACTTCAAGCAGGGGGAGTGA
AAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAAGCAAAGAATCAGCCAAACCTGTCAATCTTGATGCACAA
CGGGCAGGA
[BLAST] [AA Translate]
SGN-ID: SGN-T25131 [Download] [View] |
Facility Assigned ID: TCABD30TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 |
Expected Error Rate: 0.0100 |
Quality Trim Threshold: 14.5 |