EST details — SGN-E200284

Search information 
Request: 200284Match: SGN-E200284
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1444Clone name: cLEC-12-F20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C180920 is on microarray TOM1: SGN-S1-1-3.2.17.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180920 [TUS-35-J22] Trace: SGN-T199203 EST: SGN-E397877 Direction: 5' Facility: INRA
Clone: SGN-C180920 [TUS-35-J22] Trace: SGN-T199243 EST: SGN-E397917 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200284Length: 522 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200284 [] (trimmed) CTCAAAGTCAACAACTTAAATACTTCAAAACAAGAGTGCCTACAAAGGTATGAGTATTGCCAACTAAGCAGTTAACACCTAAATAGTCTTATTAA
GATCGACCCAACAAATAGAACTATAACTAACCAACCAAACTAGAGAACATTTTCATATATTAACAGGAAACATATCATGTGAATGCACCCTTCTA
AACTGCATGGATTGGATTGTGGCTAGAGTTCATGCCTGAGCTACCAGATGACGGATTAGCATGGAAAGCTGACTGCCTGGAGGAGCCCTCGACCA
GCTTTAGTGACAGAGAAGGTGGCTTGGCAGCATCACCAATGGACTCACCTAAGCTTAGCTTTGACATACCAACCAGCTCATCAACATTAATTGGA
CTCTTTGAATGAACAGCTGTTGGCTTCAGAACTTCATGGGTCTCTGCTATTGCTGGCTCTGCAGTGTAACCTGGCCAGCATGGATAAGGCATCGG
GTAAAATGGAGCAACATAAGCAGGATAAACAAGTGGATGCTGATATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200284] SGN-U582548 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25869 [Download] [View] Facility Assigned ID: TCABV34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5