EST details — SGN-E200304

Search information 
Request: 200304Match: SGN-E200304
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3173Clone name: cLEC-1-A11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3173 [cLEC-1-A11] Trace: SGN-T24518 EST: SGN-E200305 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200304Length: 463 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200304 [] (trimmed) TTGACCGAGTTATACCCTTAACGTCAGAATTGAAAAGAACTACTGGTGTCTTCGCTGAAACTGCATGGGCTGGTGCTGCATCCTATTTGCTGTTG
TACATGCTTGCTAGTCACATAGTTGGCTCGTTCTGGTATTTGCTTTCTGTGGAACGCTATGATACATGCTGGGAAAGAGCTTGTTGTCATAACAC
AACATGCCAAACTGATTTCTTGTACTGCGGCATTCAAGGCATGACAGGGTATAATGCTTGGAGCAATATCAGAGAATCGGTTTTAAATGGAGCAT
GCCCTCGTAGCGGTGACAATACACCATTTGATTTTGGAATTGGCGCGCAGGCTTTGTCATCAGGCATAGTTTTCTCAATGAAGATTGTGACTAAA
TATTGCTACTGTTTGTGGTGGGGACTCCAGAATTTAAGTACCCTTGGACAGGGACGTTAAACTAGCACATTTCCTGGGGAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200304] SGN-U594600 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24517 [Download] [View] Facility Assigned ID: TCAAA06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0203 Quality Trim Threshold: 14.5