EST details — SGN-E200337

Search information 
Request: 200337Match: SGN-E200337
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3215Clone name: cLEC-1-I15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3215 [cLEC-1-I15] Trace: SGN-T24549 EST: SGN-E200336 Direction: 5' Facility: TIGR
Clone: SGN-C167649 [TUS-1-A23] Trace: SGN-T411 EST: SGN-E379106 Direction: 3' Facility: Avesthagen
Clone: SGN-C167649 [TUS-1-A23] Trace: SGN-T1191 EST: SGN-E379901 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200337Length: 316 bp (951 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E200337 [] (trimmed) CAAAAGATTTACAATACGGATAATTATAACAATGTAATGAAAAACTAGACTACACATGCATAATGCATACACCTCCAAGGCCCTCTAAAAAGATC
TTTTTTTTTTTTACTCAGTACTAAGTTATACTCTACAAGAGAGCAAATAGATCGAGTTAATAAATAACAAGTCGTCATTGGGTATGATTCTTGAA
ATAGTCAAGACGACTATCAGCCAGACGTAATGAATACACAATTTGTTTAAAGTCCCCCCACTTGAAAGGCTTATAAAAATTAGTAATATTGTTGA
TTTGAGGAGGAGCACTTATTCAAGCGCCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200337] SGN-U568917 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24550 [Download] [View] Facility Assigned ID: TCAAA56TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0037 Quality Trim Threshold: 20.5