EST details — SGN-E200380

Search information 
Request: 200380Match: SGN-E200380
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3200Clone name: cLEC-1-E3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3200 [cLEC-1-E3] Trace: SGN-T24594 EST: SGN-E200381 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200380Length: 536 bp (844 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200380 [] (trimmed) ATTCTCTAGATTTGAATATGGCTTCCAAAACAATTGCAAGTCAGTCTTCAGTAACCCTTTTCCTATCACTGAATCTCCTGTTGTTTGCTGTTGTA
AGTGGAACCAATGATACTGGAAATTGCGTTGGTTCTCAACAAACATGCTCAATAGATACTTTGAAACTTGGTGTGTGTGCTAATATACTTAATTT
GGTGAATGTAATAGTCGGGTCTCCACCAACTTTGCCATGCTGCAGTTTGATCCAGGGACTGACGGACCTAGAGGCCGCGGTTTGCTTGTGCACAG
CCATAAAAGCAAATGTGCTGGGAATTAATTTGAATGTACCACTCTCTCTGAGCCTCATACTAAACACATGTGGAAAGAAATATCCTACTGGCTTC
ACTTGTTAAACTACGTATCCTCCACTCTGCCTCATTAATTTCCAAGGGGTTAATAAATAAATAAATAAATGTATCGTCGTGCTTATGAAATTATT
ATGCACGTACGAACCTTTTTAAAAAAAAATTTAAATAAGTGAACTTTGCATATGCAAGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200380] SGN-U582797 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24593 [Download] [View] Facility Assigned ID: TCAAA26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0072 Quality Trim Threshold: 12.5