EST details — SGN-E200381

Search information 
Request: 200381Match: SGN-E200381
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3200Clone name: cLEC-1-E3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3200 [cLEC-1-E3] Trace: SGN-T24593 EST: SGN-E200380 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200381Length: 297 bp (977 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E200381 [] (trimmed) TATTTATTAATTTGTTAGTATTATTAATGTAACATAGTAAGATGAGAACTTGCATATGCAAAGTTCACTTATTTAAATTTTTTTTTAAAAAGGTT
CGTACGTGCATAATAATTTCATAAGCACGACGATACATTTATTTATTTATTTATTAACCCCTTGGAAATTAATGAGGCAGAGTGGAGGATACGTA
GTTTAACAAGTGAAGCCAGTAGGATATTTCTTTCCACATGTGTTTAGTATGAGGCTCACAGAGAGTGGTACATTCAAATTAATTCCCAGCACCAT
TTGCTTTTATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200381] SGN-U582797 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24594 [Download] [View] Facility Assigned ID: TCAAA26TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0180 Quality Trim Threshold: 14.5