EST details — SGN-E200635

Search information 
Request: 200635Match: SGN-E200635
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14872Clone name: cLEC-9-G2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184003 is on microarray TOM1: SGN-S1-1-8.3.18.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184003 [TUS-43-K9] Trace: SGN-T196264 EST: SGN-E394938 Direction: 3' Facility: INRA
Clone: SGN-C184003 [TUS-43-K9] Trace: SGN-T196265 EST: SGN-E394939 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200635Length: 261 bp (436 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200635 [] (trimmed) GAACAGCGCAAACATTAGCAAAAATCGATACACTGATGTTCTGCCATTTGACAATAACAGGGTTGTTTTGGACCCACCAGCTAGAGGATATATAA
ATGCAAGCTTCATTAAGATATCTGAAGACGTGTCTCAGTTTATTGCAACACAAGGTCCTCTACAACACACTTTTGAAGACTTCTGGGAAATGATA
ATCCAGCATCGCTGTCCTGTGATTGTGATGCTTACACAATTGTTTGACAAACTACAAGATTGTCAAGTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200635] SGN-U581407 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24929 [Download] [View] Facility Assigned ID: TCABH37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0155 Quality Trim Threshold: 14.5