EST details — SGN-E200651

Search information 
Request: 200651Match: SGN-E200651
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14961Clone name: cLEC-9-M2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167673 [TUS-1-B23] Trace: SGN-T422 EST: SGN-E379260 Direction: 3' Facility: Avesthagen
Clone: SGN-C167673 [TUS-1-B23] Trace: SGN-T1201 EST: SGN-E378899 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200651Length: 336 bp (437 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200651 [] (trimmed) TATCATGGTGTCCTGCAGAGATCGTATCGGGTAATGGACATACTTACTCTGTGAGGTATGATTATTATACTTGTATGGAAAGTGAAGCGAGGTCT
GAGAGGGTTTCGAGGAGGGAGATCAGACCATGCCCCCTTCCTTCAAAGGGTGTGGAGAATGGGCAAAGTGGTCAAATTATCGAGGTGTTTAATGA
TTGTTGTTGGAAAACTTCTATTATTGTGAAGGTTTTCAATAGAGACTATTATTTAGTACACCCAACTGGATGTTCACAGGAGATTAGAGTTCATA
GATCGAACACCAGAGTGCGACAATGCTGGCAAGATGAAAAATGGCACTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200651] SGN-U574908 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24945 [Download] [View] Facility Assigned ID: TCABH73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5