EST details — SGN-E200799

Search information 
Request: 200799Match: SGN-E200799
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14851Clone name: cLEC-9-F11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186478 [TUS-50-B12] Trace: SGN-T351560 EST: SGN-E550685 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200799Length: 372 bp (464 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200799 [] (trimmed) AGGGAGTGTTGGAAGATGGACAAGAAATTGCCGTGAAGAGACTATCAAGGACTTCCATGCAAGGAATTGATGAATACAAGAACGAAGTTATCTAT
ATTGCCAAGCTTCAGCATAGAAATCTTGTGAGACTTCTGGGTTGCTGCATCCAAGGAGAAGAAAAGATGTTGATCTATGAATACATGCCTAACAA
CAGCCTAGATTCGTACATATTTGGTTTGGATTTCTAACCTATTACACCAGCTATAATGAGTAATAATCTGATCTCTTAGTGATAATATGAAAAAA
TCTGCTCACAAGAAAGCTTATTTTGCAGACCAAACAAAGAACAAATTACTTGATTGGCCAAAGATTTTCCACATCATCAACGGAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200799] SGN-U579569 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25093 [Download] [View] Facility Assigned ID: TCABI30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0005 Quality Trim Threshold: 14.5