Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E200884

Search information 
Request: 200884Match: SGN-E200884
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C9249Clone name: cLEC-5-C24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167827 [TUS-1-I9] Trace: SGN-T488 EST: SGN-E379720 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200884Length: 388 bp (504 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200884 [] (trimmed) GGGAAATCGCCTAAATGGTTCAATTCCAAGCTATTTATTTCATTGGAAGAATTTAACATCTCTTCTTTTGGGGGATAACCAATTTTCCGGGAATT
TACCTAGTATAACTGGAAATTTGAGATTAAGAACATTGGATCTTTCGTCGAATCAGCTTTCTGGACATATTCCAAAAGAATATGACAAGAAAGAA
TACAACTTTAGAAATAATCTGAATCTGTGTAGCAAATATACCAACCATTACATCCAGGTTCCACGTTGCAGTGGAAAAACAAGAGTTGTAATTGC
TGTTGTGGCCCCTGTTGCATTTTTAGTCATGGTAACATTGCTATGTTATACATGTAAAAAGAATTGGTCTTTCTCCACAGACCAACTCATGCGGA
GGAAGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200884] SGN-U575472 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23719 [Download] [View] Facility Assigned ID: TCAAR24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5