EST details — SGN-E200998

Search information 
Request: 200998Match: SGN-E200998
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C9276Clone name: cLEC-5-E18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167888 [TUS-1-K22] Trace: SGN-T114 EST: SGN-E379325 Direction: 5' Facility: Avesthagen
Clone: SGN-C167888 [TUS-1-K22] Trace: SGN-T675 EST: SGN-E379656 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200998Length: 381 bp (507 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200998 [] (trimmed) CTTCAGGAATCTCAAGAGTTAAGTGTCAGTGCGAGAGAAGTTGATACCAAGGTTGGTGGAGAACTTTCTGAAGCAAATTATAAGCCTGAGCTGAA
ACCTGCAACTTATGCAGAGAAAGTGAAATCTGGACTAAGTGATCCTATCTTAAGTAATAATATCCAGTCCGAGTCTGCTTCCAGGAAGACAGAGC
TTCATTGGGGTGATGCATCTTCACATGGAGCCGAGGGAAACAAAGAAGCAGAGCAACTACACTCTTTGGCTGAGAAAGAGTGTCAGGTTGGAGCA
GCAGTTTCCACAGGGATACCCTCTGGTACTGTTGGTACACTTGAGCATGGAAGCATTCTTTTTGACATTAATGACTGCTTTCCCCGTGATTTTCT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200998] SGN-U577536 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23833 [Download] [View] Facility Assigned ID: TCAAR33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5