EST details — SGN-E201015

Search information 
Request: 201015Match: SGN-E201015
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C9232Clone name: cLEC-5-B6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201015Length: 208 bp (755 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E201015 [] (trimmed) ACAAGGTTTCAAAGGTCATACTTATAAGTTTTTGTTTGGGGATATGAAAGAGATGAGCAAGATGGGTGAAGAAGCTTGGTCCAAGCCTGTTAATT
TCTCCCATGACACGATTTGGCCTAGAGTGAACCCATTCATACACAAAATCATCACAAACTATGGTAAGAATTGTTTTGTGTGGTTTGGGCCAAGA
CCAGCAGTGGTGATCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201015] SGN-U578818 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23850 [Download] [View] Facility Assigned ID: TCAAT03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5