SGN ID: SGN-C929 | Clone name: cLEC-10-C13 |  | Order Clone |
|
Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E201063 | Length: 374 bp (854 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E201063 [] (trimmed)
ATCTGATCTTTCTCATATATACCGATTGTTTTACCAAATCCATGAATACCATAACTATACTCATTTATACAAAGCTACTGAGTCCTCCTTAGCCA
ACTTGCTCTTTAAGGAAAACCCTCTTCCACTTTTCTACGGGCCATCTGTTCTTCTACTTGAAGTCTCTCCAACCCCTTTTGACGAACCTAAAAAT
ACTACAGACGAAGGGTTCAAGCCTGTCCTTACAACGTTTGACCTTAAATTCCCAGTCGTAGAAGGAGAAGTTGAGGAATTCCGATCCAAATATGA
TGATAAGAGTGATGTTTACATCGCAGGATATGCTTTCTTTTACGCGAATTATTCATGCTTTTATGACAAGCCTGGATTTTATTTCGAGA
[BLAST] [AA Translate]
SGN-ID: SGN-T24650 [Download] [View] |
Facility Assigned ID: TCABK19TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 |
Expected Error Rate: 0.0070 |
Quality Trim Threshold: 14.5 |