EST details — SGN-E201274

Search information 
Request: 201274Match: SGN-E201274
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1012Clone name: cLEC-10-H17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184043 is on microarray TOM1: SGN-S1-1-8.1.19.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184043 [TUS-43-M1] Trace: SGN-T196631 EST: SGN-E395305 Direction: 3' Facility: INRA
Clone: SGN-C184043 [TUS-43-M1] Trace: SGN-T199754 EST: SGN-E398428 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201274Length: 369 bp (645 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201274 [] (trimmed) GGAAAGCAAACAAGTCAAGAGAACCTATTATTCCAAAGAAAGATTTACCTGAGGTGAGTCCTGAAGCAAAGAAGAAAGCTGCAGATGCAAAGGCG
AGGGCAGACGAGGCATTTAATAGGAAAGATTTTGCTACAGCTATAGATACTTACACGCAGGCAATCGATTTTGATCCAACTGATGGCACTCTGTT
TTCCAATAGAAGTCTTTGTTGGCTCCGCCTGGGCCAAGCTGAACGCGCCTTAAGTGATGCCAGGGCCTGCAGAGAACTTAGACCAGATTGGGCAA
AAGGTTGTTATCGGGAAGGTGCAGCTCTACGTCTATTGCAGAGGTTTGAAGAGGCAGCCAATGCTTTCTATGAGGGTGTACAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201274] SGN-U578144 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24861 [Download] [View] Facility Assigned ID: TCABM45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5